Plot the Guide Strand with different optional seeds
Arguments
- guide.seq
Guide a.k.a anti-sense sequence oriented 5' > 3'. Sequence must be greater than 8 bp.
Examples
library(msa)
#> Loading required package: Biostrings
#> Loading required package: BiocGenerics
#>
#> Attaching package: ‘BiocGenerics’
#> The following objects are masked from ‘package:stats’:
#>
#> IQR, mad, sd, var, xtabs
#> The following objects are masked from ‘package:base’:
#>
#> Filter, Find, Map, Position, Reduce, anyDuplicated, aperm, append,
#> as.data.frame, basename, cbind, colnames, dirname, do.call,
#> duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
#> lapply, mapply, match, mget, order, paste, pmax, pmax.int, pmin,
#> pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table,
#> tapply, union, unique, unsplit, which.max, which.min
#> Loading required package: S4Vectors
#> Loading required package: stats4
#>
#> Attaching package: ‘S4Vectors’
#> The following object is masked from ‘package:utils’:
#>
#> findMatches
#> The following objects are masked from ‘package:base’:
#>
#> I, expand.grid, unname
#> Loading required package: IRanges
#> Loading required package: XVector
#> Loading required package: GenomeInfoDb
#>
#> Attaching package: ‘Biostrings’
#> The following object is masked from ‘package:base’:
#>
#> strsplit
# Ttr siRNA sequence
guide.seq = "UUAUAGAGCAAGAACACUGUUUU"
# generate seed plot
plotted.seeds = plot_seeds(guide.seq)
#> use default substitution matrix
#> Registered S3 methods overwritten by 'ggalt':
#> method from
#> grid.draw.absoluteGrob ggplot2
#> grobHeight.absoluteGrob ggplot2
#> grobWidth.absoluteGrob ggplot2
#> grobX.absoluteGrob ggplot2
#> grobY.absoluteGrob ggplot2
#> Scale for x is already present.
#> Adding another scale for x, which will replace the existing scale.