SeedMatchR output formats
Tareian Cazares
SeedMatchR_OutputFormats.Rmd
library(SeedMatchR)This example uses the siRNA sequence, D1, targeting the Ttr gene in rat liver from the publication:
Schlegel MK, Janas MM, Jiang Y, Barry JD, Davis W, Agarwal S, Berman D, Brown CR, Castoreno A, LeBlanc S, Liebow A, Mayo T, Milstein S, Nguyen T, Shulga-Morskaya S, Hyde S, Schofield S, Szeto J, Woods LB, Yilmaz VO, Manoharan M, Egli M, Charissé K, Sepp-Lorenzino L, Haslett P, Fitzgerald K, Jadhav V, Maier MA. From bench to bedside: Improving the clinical safety of GalNAc-siRNA conjugates using seed-pairing destabilization. Nucleic Acids Res. 2022 Jul 8;50(12):6656-6670. doi: 10.1093/nar/gkac539. PMID: 35736224; PMCID: PMC9262600.
The guide sequence of interest is 23 bp long and oriented 5’ -> 3’.
# siRNA sequence of interest targeting a 23 bp region of the Ttr gene
guide.seq = "UUAUAGAGCAAGAACACUGUUUU"Load annotation databases
annodb = load_annotations(reference.name = "rnor6", canonical = FALSE, min.feature.width = 8, longest.utr = T)Prepare DESEQ2 Results
The DESeq2 results are available through the names
Schlegel_2022_Ttr_D1_30mkg,
Schlegel_2022_Ttr_D4_30mkg and
Schlegel_2022_Ttr_D1_10mkg. The data set name is long, so
it will be renamed to res. The DESeq2 results file is then
filtered. The function filter_res() can be used to filter a
results file by log2FoldChange, padj, baseMean, and remove NA
entries.
get_example_data("sirna")
sirna.data = load_example_data("sirna")
res <- sirna.data$Schlegel_2022_Ttr_D1_30mkg
res = filter_res(res, fdr_cutoff=1, fc_cutoff=0)DESeq2 column output
res.de = SeedMatchR(res = res,
seqs = annodb$seqs,
sequence = guide.seq,
seed.name = "mer7m8")
head(res.de)Data frame output
You can perform a seed match for a single seed using the
SeedMatchR() function.
res.df = SeedMatchR(seqs = annodb$seqs,
sequence = guide.seq,
seed.name = "mer7m8",
res.format = "data.frame")
head(res.df)GRanges output
You can perform a seed match for a single seed using the
SeedMatchR() function.
res.gr = SeedMatchR(seqs = annodb$seqs,
sequence = guide.seq,
seed.name = "mer7m8",
res.format = "granges")
head(res.gr)IRanges output
You can perform a seed match for a single seed using the
SeedMatchR() function.
res.ir = SeedMatchR(res = res,
seqs = annodb$seqs,
sequence = guide.seq,
seed.name = "mer7m8",
res.format = "iranges")
head(res.ir)